Molecular characterization of gene encoding halo tolerant amylase of Bacillus paralicheniformis isolated from Jazan region

Collection of samples from soil

Soil samples were collected from various regions of Jazan, including Sabya, Baish, Shaqiq, and Farasan Island. Soil samples were taken from 3 to 5 cm depth after removing 5 cm from ground surface. These samples were collected into sterilized plastic bags and stored into iceboxes during their transport to the laboratory. In the laboratory, all samples were kept refrigerated until isolation.^[8]

Isolation of amylase producing bacterial isolates

One gram of soil was suspended in 9 ml sterile distilled water; diluted logarithmically up to 10^-5 level. 1 ml of the dilution was seeded on starch agar plate (g/l) (peptic digest of animal tissue 5.0, yeast extract 1.5, beef extract 1.5, scratch 2.0, sodium chloride 5.0, and agar 15.0, HiMedia, India) and incubated at 30°C for 72 h. Bacterial isolates grown from the previous step were streaked on new starch agar plate and incubated at 30°C for 48 h. After the growth of colonies, iodine solution (g/100 ml water) (Iodine 0.34, Potassium iodide 0.66) was flooded with dropper for 30 s on the starch agar plate. The presence of blue color around the growth indicates negative result and a clear zone of hydrolysis around the growth indicates positive result. The colonies were transferred and maintained on starch agar slants at 4^oC.^[9]

Gram staining

The Gram stain was done according to^[10] Gephardt et al., 1981.

Screening of amylase producing halophilic bacterial isolates

To screen for halophilic amylase producing bacteria, the iodine positive bacterial isolates were grown on starch agar plate (g/l) (peptic digest of animal tissue 5.0, yeast extract 1.5, beef extract 1.5, strach 2.0, sodium chloride 5.0, and agar 15.0 from HiMedia company, India) supplemented with different NaCl concentrations including (7%, 10%, 12%, 14%, and 16%).^[11]

16S rRNA Identification of halophilic bacterial isolates

The highest amylase producing halophilic bacteria were identified by using 16S rRNA method according to Abada et al., 2018.^[12] Total genomic DNA was isolated from the bacterial cells using phenol–chloroform method as described by Ruzzante et al., 1996.^[13] Isolated DNA was checked for its quality and concentration by agarose gel electrophoresis using UV transilluminator. 16S rRNA region was amplified with universal primers named 27F 5’(AGAGTTTGATCMTGGCTCAG)3’ and 1492R 5’ (TACGGYTACCTTGTTACGACTT)3’. The PCR amplification was performed using a Thermal cycler (BioRad), with a primary heating step for 2 min at 95°C, followed by 30 cycles of denaturation for 20 s at 95 C, annealing for 60 s at 55 C, and extension for 2 min at 72°C, then followed by a final extension step for 7 min at 72°C. Each 25 μl reaction mixture contained 2 μl of genomic DNA, 14.25 μl of MilliQ water, 2.5 μl of 10X buffer (100 mM Tris–HCl, pH 8.3; 500 mM KCl), 1.5 μl of MgCl₂ (25 mM), 2.5 μl of dNTPs mixture (dATP, dCTP, dGTP, and dTTP 10 mM), 1.0 μl of each primer (20 pmol/ml), and 0.25 μl of Taq DNA polymerase (Thermo). The amplified fragments were purified from agarose gels using (Gene JET TM PCR purification Kit) (Thermo). Finally, the PCR product was sequenced by GATC Company (GATC Company, South Korea) by the use of ABI 3730 xl DNA sequencer. After sequencing, sequence was retrieved from public databases using BLAST at the NCBI server.

Molecular identification of amylase gene (AMY) from the bacterial isolates

Isolation and purification of amylase producing bacterial isolates

Soil samples were collected from various regions of Jazan, including Sabya, Baish, Al-Shuqaiq, and Farasan Island as shown in [Figure 1].

Close

Figure 1:

Area of the soil samples collection from Jazan region.

Export to PPT

Soil samples were taken from 3 to 5 cm depth after removing 5 cm from ground surface. Ten-gram representative soil sample was suspended in 90 ml of sterile tap water and shaken thoroughly for 10 min. The samples were grown on starch agar plates and incubated at 30°C for 24–48 h. The growth of bacterial colonies was observed and studied morphologically. The total bacterial count was in a range of 4 × 10^-3 CFU. All bacterial isolates were white in color, circular with entire edge.

Amylase screening test

Amylolytic activities of the soil bacterial isolates were screened on starch agar plates. After incubation at 30°C for 72 h, the zone of clearance was determined by flooding the plates with iodine solution. The potential amylase producers were selected based on zone of clearance diameter. Our results showed that the average of clear zone was between 0.5 and 2 cm [Figure 2]. Twenty isolates were selected for further studies.

Close

Figure 2:

Amylase test activity for the amylase potent bacterial isolate from soil.

Export to PPT

Gram stain test

The Gram stain test showed that all isolates were Gram-positive bacilli.

Selection of halophilic amylase producing bacteria

The twenty-amylase producing bacterial isolates were growing in different concentration of NaCl starch agar medium ranging from (7–16%), respectively. Only one sample named S1 was able to hydrolyze starch up to 14 % NaCl with clear zone of 1.4 ± 0.1 but there was no growth on 16 % NaCl.

Molecular identification of bacterial strains by 16S rRNA

Our results showed that there are PCR products of around 1500 bp visualized [Figure 3]. The PCR products were purified using PCR purification kit (Qiagen). The purified PCR were sequenced using ABI Prism 3730XL DNA analyzer (Applied BioSystems). The sequence results of the PCR product using gene bank homology public databases BLAST at the NCBI server (http://www.ncbi.nlm.nih.gov/blast/). Our results showed that sample S1 identified as B. paralicheniformis [Figures 3 and 4].

Close

Figure 3:

PCR amplified 16s rRNA of S1 isolate using primer 27F and 1492R

Export to PPT

Close

Figure 4:

Phylogenetic tree analysis of the 16S rRNA gene sequence of the S1

Export to PPT

Molecular identification of AMY of B. paralicheniformis

B. paralicheniformis bacteria were chosen to identify their Amy gene since they can grow up to 14% NaCl. To identify the Amy of B. paralicheniformis specific primers were designed named S1F 3’(GATTGCTGCCGCTGTTATTT)5’, and S1R 3’(TATCTTTGAACATAGATCGAAACCGA)5’; respectively. The specific primers were used to amplify the Amy gene using the PCR technique. The PCR protocol was 5 min initial melting at 95°C, 30 s 95°C, 30 s 60°C, and 1 min at 72°C. Our results showed that we have two PCR products of about 1500 bp when the Amy gene of B. paralicheniformis was amplified by S1F and S1R primers, respectively [Figure 5].

Close

Figure 5:

PCR product of the amy gene of the Bacillus paralicheniformis. Lane 1, DNA ladder marker, Lane 2, PCR product of primer S1F while Lane 3, PCR product of primer S1R.

Export to PPT

Sequencing the full length of amy gene of the strains B. paralicheniformis

The PCR products of the amy genes of B. paralicheniformis were purified from the agarose gel by Multiscreen filter plate (Millipore Crop.). To get the full length of the Amy gene, the purified PCR products of the Amy genes were sequenced using S1F and S1R specific primers. The BigDye (R) terminator v3.1 cycle sequencing kit was used and ABI prism 3730XL analyzer with variant reporter version 2.1 as a software for variant analysis. The full length of Amy gene of B. paralicheniformis showed 93.73% homology with Amy gene of Bacillus licheniformis DSM 13 (https://blast.ncbi.nlm.nih.gov/Blast) and 79.8% homology with Amy gene of Bacillus glycinifermentans BGLY [Figure 6]. The DNA analysis of the full-length Amy gene was of 1452 bp encoding 483 amino acids. The expected M.Wt. of the protein expressed is of 55 KDa.

Close

Figure 6:

Alignment view of the amy gene of Bacillus paralicheniformis (Query) and the amy gene of the Bacillus licheniformis (Subject).

Export to PPT

Isolation and molecular identification of halophilic amylase producing bacteria from Jazan region

Enzymes are not only essential for carrying out biochemical reactions within an organism but also their high specificity and catalytic characteristics have enabled them to be used in various industrial sectors for the production of a wide range of products. Amylase is one of those enzymes. Globally, amylase is being frequently used in food, textile, detergents, and paper industries. In addition, pharmaceutical and chemical industries use amylase on a regular basis to yield their products.^[16] However, there is no local production of commercial amylase and thus lot of money is spent on the process of enzyme import. Harmful chemicals are also used as an alternative to amylase.^[5] For this reason, it is necessary that a process is established to generate commercial amylase. Since industrial amylase is usually extracted from bacteria and fungi, it is mandatory to isolate a local high amylase producing strain. In this study, the main aim was to isolate halophilic amylase producing bacterial strain from different habitat in Jazan region and to identify the strain through genotypic methods. Furthermore, the full length sequence of the amylase gene was to identify.

Due to the availability of various types of bacteria in soil of Jazan, it was chosen as the source of bacterial isolation. The soil collected for this study was from Sabia, Baish, Al-Shuqaiq, and Farasan Island. In primary screening of the bacterial strains, it was observed that 20 out of hundreds of isolates were halophilic amylase producers. This was determined by growing the isolates on starch agar medium supplemented by different concentration of NaCl ranging from 7 to 16% and detecting any clear zone production around the bacterial colonies by adding Gram’s iodine. The clear zones produced were due to the absence of starch which was hydrolyzed by the amylase enzyme excreted by the bacteria. Our results showed that one sample was able to hydrolyze starch up to 14% NaCl but there was no growth on 16% NaCl. The S1 isolate was able to hydrolysis starch up to 14% NaCl with clear zone of 1.4. The 16S rRNA gene homology had revealed that S1 was identified as B. paralicheniformis, with 99% homology.

Spread plate technique was adopted to isolate discrete colonies.^[17] Bacterial strains were screened for their ability to produce α-amylase by streaking them on starch agar plates. Screening and isolation of alpha-amylase producing fungi and bacteria from marine water and soil using enrichment techniques were reported by Medda and Chandra (1980) and Pretorius et al. (1986).^[18,19] Different sources of fungi (seventy-eight strains of Aspergillus oryzae) were reported to be isolated from soils of different habitats by serial dilution method (Clark et al., 1958).^[20] The high yielding 17 isolates were partially identified using protocols given in Bergey’s manual of determinative bacteriology. Similarly using protocols given in Bergey’s manual of determinative bacteriology, the partial identification of bacteria was performed and identified as Bacillus spp.^[21,22] Sneath et al. (1986); and Ajayi and Fagade (2003) have reported several bacterial isolates, based on the zone of starch hydrolysis. They were reported as Bacillus sp.1 and Bacillus sp.2, which produced more α-amylase enzyme. Bacterial identification was performed on randomly selected colonies using standard bacterial taxonomy procedures according to the 8^th edition of Bergey’s Manual of Determinative Bacteriology.

Molecular Identification of amy gene of B. paralicheniformis

Our results showed that the full length of Amy gene of B. paralicheniformis had 93.73% homology with Amy gene of Bacillus licheniformis DSM 13 (https://blast.ncbi.nlm.nih.gov/Blast) and 79.8% homology with Amy gene of Bacillus glycinifermentans BGLY. The DNA analysis of the full length Amy gene was of 1452 bp encoding 483 amino acids. The expected M.Wt. of the protein expressed is of 55 KDa. While, moreover, Haloarcula japonica amylase was of 1989 nucleotides encodes 663 amino acids.^[23] Evidently, the halophilic enzymes have typical enzymatic properties with additional polyextremities, namely, salt requirement for activity and stability, alkaline inclination, and resistance to unfolding even with high concentration of chaotropic reagents. This raises interest in their structure and adaptive features at molecular level. It has been reported that the full length of the amylase gene of Natronococcus sp. was of 1512 bp with signal peptide of 43 amino acids.^[24] Halothermothrix orenii amylase gene was of 1545 encoding 490 amino acids^[25,26]. Identified the amylase gene of Exiguobacterium sp. was 1545 bp with Open Reading Frame (ORF) encodes 514 amino acids. ^[27]. Cloned a novel gene (amyZ) encoding a salt-tolerant and cold-active α-amylase (AMYZ) from a marine bacterium Zunongwangia profunda, and the protein was expressed in Escherichia coli. The gene has 1785 bp length and encodes an α-amylase of 594 amino acids with an estimated molecular mass of 66 kDa. Choubane et al.^[28] (2015) isolated α-amylase-producing Bacillus sp. R2 from Red Sea water at Hurghada, Egypt. They prepared readily available medium using pasta cooking water as basal medium for industrial amylase production Kanpiengjai et al., (2015).^[29] Isolated and characterized a maltose-forming amylolytic lactic acid bacterium Lactobacillus plantarum S21. The main hydrolysis by-products from starch, amylose, amylopectin, as well as glycogen were maltose (60%) and glucose (38%). The amylase gene encodes a protein consist of 910 amino acids including a signal peptide sequence. Khusro and Aarti (2015)^[30] isolated five hyper-amylase-producing Bacillus strains from poultry feces soil sample. A maltotriose-producing α-amylase, from Microbulbifer thermotolerans DAU221, a newly isolated bacterial strain was purified and characterized by Lee et al. (2015).^[31] Liaquat et al. (2015 ^[32] isolated partial characterized, and purified α-amylase by B. subtilis (RAS-1) and Clostridium perfringens (RAS-4) from anaerobic digester carrying anaerobic co-digestion of cow manure with fruit-vegetable waste and agricultural residues in continuous stirred tank reactor. Their results suggested the cost-effective production of α-amylases enzyme from organic waste during biogas production. The purified α-amylase with a molecular weight of approximately 80 kDa shared a sequence motif characteristic of the glycoside hydrolase family 13. Purification of extracellular amylase produced by the bacterium, Corynebacterium alkanolyticum ATH3 isolated from the distal intestine of Anabas testudineus, a freshwater fish, was carried out using column chromatography ^[33]. Best to our knowledge, this is the 1st study to identify halophilic amylase producing bacteria from soil and water of Jazan region. Further plans will include expression of the Amy gene of B. paralicheniformis encoded by the 1452, respectively, using different expression system. The recombinant form of the amylase of both isolates will be evaluated before large-scale production.